Review




Structured Review

Genechem hdac5 mrna
Hdac5 Mrna, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hdac5+mrna/hdac5+lentivirus+overexpression/pm41436435-53-6-42
Average 86 stars, based on 1 article reviews
hdac5 mrna - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Control:

Article Title: TNF-α-driven m6A modification disrupts the immunoregulatory function of MSCs by regulating HDAC5-dependent super-enhancers.
Article Snippet: Further experiments were performed after 72 h. dCas13b-ALKBH5 lentiviral construction and transfection The dCas13b-ALKBH5 lentiviral, which expresses a fusion protein of catalytically inactive LwaCas13b and the human m6A demethylase ALKBH5, was purchased from GeneChem Technology. .. For site-specific manipulation of m6A at HDAC5 mRNA, gRNA targeting the regions upstream of the predicted m6A sites on HDAC5 mRNA (gRNA-1 for site 1: TCCAAAGAAGCATGGTGGGCTCC; gRNA-2 for site 2: CAAATCCATTCTTGAGCTCTCCT) and a non-targeting control gRNA (NT-gRNA) were designed and produced by GeneChem Technology. ..

Produced:

Article Title: TNF-α-driven m6A modification disrupts the immunoregulatory function of MSCs by regulating HDAC5-dependent super-enhancers.
Article Snippet: Further experiments were performed after 72 h. dCas13b-ALKBH5 lentiviral construction and transfection The dCas13b-ALKBH5 lentiviral, which expresses a fusion protein of catalytically inactive LwaCas13b and the human m6A demethylase ALKBH5, was purchased from GeneChem Technology. .. For site-specific manipulation of m6A at HDAC5 mRNA, gRNA targeting the regions upstream of the predicted m6A sites on HDAC5 mRNA (gRNA-1 for site 1: TCCAAAGAAGCATGGTGGGCTCC; gRNA-2 for site 2: CAAATCCATTCTTGAGCTCTCCT) and a non-targeting control gRNA (NT-gRNA) were designed and produced by GeneChem Technology. ..



Similar Products

98
MedChemExpress hdac5 mrna in vivo
Hdac5 Mrna In Vivo, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hdac5+mrna/MPZL1%2C+Human/pmc05899012-77-20-26
Average 98 stars, based on 1 article reviews
hdac5 mrna in vivo - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

86
Genechem hdac5 mrna
Hdac5 Mrna, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hdac5+mrna/hdac5+lentivirus+overexpression/pm41436435-53-6-42
Average 86 stars, based on 1 article reviews
hdac5 mrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

98
MedChemExpress mid2681 targets hdac5 mrna in vivo
Mid2681 Targets Hdac5 Mrna In Vivo, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hdac5+mrna/MPZL1%2C+Human/pm29076015-2228-13-20
Average 98 stars, based on 1 article reviews
mid2681 targets hdac5 mrna in vivo - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

Image Search Results